Covid-19: bewijs van globale fraude

6
5854

De zogenaamde Corona-pandemie is een fraude van monumentale proporties. Dat zegt de gravende journalist Iain Davis, die het bewijs samenvat in een uitgebreid artikel dat Frontnieuws vandaag in het Nederlands publiceert. Covid-19 en de daaropvolgende acties van de regeringen lijken deel uit te maken van een internationale samenzwering om fraude te plegen. Er lijkt geen bewijs te zijn dat een virus genaamd SARS-CoV-2 een ziekte veroorzaakt die Covid-19 heet.

Soms moet je je intuïtie volgen. Ik ben geen genetische expert en zoals altijd, corrigeer me als ik het mis heb. Maar mijn aandacht werd gevestigd op een onderzoeksrapport van het Spaanse medische tijdschrift D-Salud-Discovery. Hun adviesraad met prominente gekwalificeerde artsen en wetenschappers geeft hun onderzoek extra geloofwaardigheid. Hun claim is verbazingwekkend.

De genetische primers en sondes die in RT-PCR-tests worden gebruikt om SARS-CoV-2 te identificeren, zoeken niets specifieks. Ik heb de zoektechnieken gevolgd die worden beschreven in deze Engelse vertaling van hun rapport en kan de juistheid van hun beweringen over de nucleotidesequenties zoals uiteengezet in de protocollen van de Wereldgezondheidsorganisatie bevestigen. U kunt hetzelfde doen.

D-Salud-Discovery stelt dat er geen tests zijn die SARS-CoV-2 kunnen identificeren. Bijgevolg zijn alle beweringen over de vermeende impact van COVID-19 op de gezondheid van de bevolking ongegrond.

Het hele officiële Covid-19-narratief is een illusie. Er is duidelijk geen wetenschappelijke basis voor enig onderdeel ervan.

Als deze uitspraken juist zijn, kunnen we stellen dat er geen bewijs is van een pandemie, maar slechts een illusie van een pandemie. We hebben onbeschrijfelijke verliezen geleden zonder aanwijsbare reden, afgezien van de ambities van gewetenloze despoten die de wereldeconomie en onze samenleving willen aanpassen aan hun doeleinden.

Deze parasietenklasse heeft daarbij potentieel talloze misdaden begaan. Deze misdaden kunnen en moeten worden onderzocht en vervolgd in een rechtbank.

Identificatie van wat precies?

De Wereldgezondheidsorganisatie (WHO) heeft COVID-19 (COronaVIrus Disease 2019) geclassificeerd. Zij hebben op 11 maart 2019 een globale Covid-19 pandemie uitgeroepen.

De richtsnoeren van de WHO voor laboratoriumtests luiden als volgt:

“Het etiologische agens [oorzaak van de ziekte] dat verantwoordelijk is voor de cluster van longontstekingsgevallen in Wuhan is geïdentificeerd als een nieuw betacoronavirus (in dezelfde familie als SARS-CoV en MERS-CoV) via next generation sequencing (NGS) uit gekweekte virussen of rechtstreeks uit monsters van verschillende longontstekingspatiënten”.

De WHO beweert dat het SARS-CoV-2-virus de ziekte COVID-19 veroorzaakt. Ze beweren ook dat dit virus duidelijk is geïdentificeerd door onderzoekers in Wuhan.

In het Novel Coronavirus 2019-nCov Situation Report 1 van de WHO stellen zij:

Deze twee verklaringen van de WHO suggereren duidelijk dat het SARS-CoV-2-virus werd geïsoleerd (d.w.z. gezuiverd voor studie) en dat vervolgens uit het geïsoleerde monster genetische sequenties werden geïdentificeerd. Hieruit werden diagnostische kits ontwikkeld en wereldwijd verspreid om te testen op het virus in steden en gemeenschappen over de hele wereld. Volgens de WHO en Chinese onderzoekers zullen deze tests het virus vinden dat Covid-19 veroorzaakt.

“De Chinese autoriteiten hebben een nieuw type coronavirus geïdentificeerd, dat op 7 januari 2020 werd geïsoleerd……Op 12 januari 2020 deelde China de genetische volgorde van het nieuwe Coronavirus voor landen om te gebruiken bij de ontwikkeling van specifieke diagnostische kits”.

WHO zegt ook:

“Het team werkte rechtstreeks op basis van sequentie-informatie en ontwikkelde een reeks genetische amplificatietesten (PCR’s), die door laboratoria worden gebruikt”.

De Wuhan-wetenschappers ontwikkelden hun genetische amplificatietests op basis van “sequentie-informatie” omdat er geen geïsoleerd, gezuiverd monster van het zogenaamde SARS-CoV-2-virus was. Ze toonden ook elektronenmicroscoop beelden van de nieuw ontdekte virionen (het piekerige eiwitbolletje dat het virale RNA bevat).

Dergelijke eiwitstructuren zijn echter niet uniek. Ze zien er net zo uit als andere ronde blaasjes, zoals endocytische blaasjes en exosomen.

Virologen beweren dat het niet mogelijk is om een virus te “isoleren” omdat ze zich alleen in de gastheercellen vermenigvuldigen. Ze voegen eraan toe dat de stellingen van Koch niet van toepassing zijn omdat ze betrekking hebben op bacteriën (die levende organismen zijn). In plaats daarvan observeren virologen de cytopathogene effecten van het virus (CPE), die celmutatie en -afbraak veroorzaken, in celculturen.

Toen Chinese onderzoekers voor het eerst de sequentie van het volledige SARS-CoV-2-genoom bepaalden, observeerden ze CPE in Vero E6- en Huh7-cellen. Vero E6 is een vereeuwigde cellijn van aap en Huh7 zijn vereeuwigde kankercellen (tumorigene). (tumorcellen). Dit betekent dat ze jarenlang in vitro (in petrischaaltjes) worden onderhouden.

Centraal in het officiële SARS-CoV-2 verhaal staat het idee dat het een zoönotisch virus is, dat in staat is om de kloof tussen dier en mens te overbruggen. Toen wetenschappers van het Amerikaanse CDC verschillende cellen met het nieuwe virus “infecteerden”, merkten ze het volgende op:

“We onderzochten het vermogen van SARS-CoV-2 om te infecteren en te repliceren in verschillende gangbare primaten- en menselijke cellijnen, waaronder menselijke adenocarcinoomcellen (A549) [longcellen], menselijke levercellen (HUH7). 0), en menselijke embryonale niercellen (HEK-293T), naast Vero E6 en Vero CCL81 [apencellen]…Er werd geen cytopathisch effect waargenomen in een van de cellijnen, behalve in Vero-cellen [apencellen]…HUH7.0 en 293T cellen toonden slechts bescheiden virale replicatie en A549 cellen [menselijke longweefselcellen] waren onverenigbaar met SARS-CoV-2 infectie”.

De CDC nam geen CPE in menselijke cellen waar. Ze zagen geen bewijs dat dit vermeende virus een menselijke ziekte veroorzaakte. Noch toonde dit vermeende menselijke virus enige opmerkelijke replicatie in menselijke cellen, wat suggereert dat een infectie van mens tot mens onmogelijk zou zijn.

Toen zij dit probleem opmerkten, introduceerde een team van Poolse wetenschappers dit sequentiële “virus” in menselijke epitheelcellen (luchtwegcellen). Zij observeerden de effecten op deze HAE-culturen gedurende 5 dagen. Ze merkten veel grotere replicatie op dan de CDC-wetenschappers, maar verklaarden uiteindelijk:

“We hebben geen vrijlating van het virus waargenomen aan de basolaterale zijde van de HAE-kweek”.

Wat betekent dat ze geen enkel bewijs zagen van de vermeende virussen die het celwandmembraan doorbraken. Opnieuw suggererend dat dit zogenaamde virus niet besmettelijk is bij de mens.

Het is niet duidelijk dat SARS-CoV-2 een menselijk virus is dat ziekte kan veroorzaken. Het kan zelfs fysiek niet bestaan. Is het niets meer dan een concept dat gebaseerd is op voorspellende genetische sequenties?

De ontdekkingsreis

Het Wuhan Center for Disease Control and Prevention en het Shanghai Public Health Clinical Centre heeft het eerste volledige SARS-CoV-2 genoom (MN908947.1 ) gepubliceerd. Dit is vele malen bijgewerkt. MN908947.1 was echter de eerste genetische sequentie die het vermeende etiologische middel Covid-19 (SARS-CoV-2) beschrijft.

Alle daaropvolgende claims, tests, behandelingen, statistieken, de ontwikkeling van vaccins en het daaruit voortvloeiende beleid zijn op deze sequentie gebaseerd. Als de tests voor dit nieuwe virus niet iets identificeren dat in staat is om ziekte bij mensen te veroorzaken, dan is het hele Covid-19 narratief niets anders dan een schertsvertoning.

De Wuhan-onderzoekers verklaarden dat ze de genetische sequentie van SARS-CoV-2 effectief hadden samengesteld door fragmenten die in monsters werden gevonden, te matchen met andere, eerder ontdekte genetische sequenties. Van het verzamelde materiaal vonden ze een overeenkomst van 87,1 procent met het SARS-coronavirus (SARS-CoV). Ze gebruikten de novo assembly en gerichte PCR-technologie en vonden 29.891 basenparen die een sequentieovereenkomst van 79,6 procent deelden met SARS-CoV.

Ze moesten “de novo assembly” gebruiken omdat ze geen voorkennis hadden van de juiste volgorde of volgorde van deze fragmenten. De bewering van de WHO dat Chinese onderzoekers het virus op 7 januari hebben geïsoleerd, is simpelweg onjuist.

Het Wuhan-team gebruikte 40 cycli van RT-qPCR-amplificatie om fragmenten van cDNA (complementair DNA geconstrueerd uit bemonsterde RNA-fragmenten) te matchen met het gepubliceerde SARS-Coronavirus-genoom (SARS-CoV). Helaas is het ook niet duidelijk hoe nauwkeurig het originele SARS-CoV-genoom is.

In 2003 bestudeerde een team van onderzoekers uit Hong Kong 50 patiënten met ernstig acuut respiratoir syndroom (SARS). Zij namen monsters van 2 van deze patiënten en ontwikkelden een kweek in foetale apenlevercellen.

Ze creëerden 30 klonen van het genetisch materiaal dat ze vonden. Ze konden geen bewijs vinden van enig ander bekend virus, in slechts één van deze gekloonde monsters vonden ze genetische sequenties van “onbekende oorsprong”.

Bij het onderzoek van deze onbekende RNA-sequenties vonden ze 57% overeenkomst met het boviene coronavirus en het muriene hepatitisvirus en leidden daaruit af dat het van de familie Coronaviridae was. Gezien deze sequenties om een nieuw ontdekt SARS-CoV-virus te suggereren (nieuwe ontdekkingen zijn ambrosia voor wetenschappers), ontwierpen ze RT-PCR-primers om te testen op dit nieuwe virus. De onderzoekers verklaarden:

“Primers voor het opsporen van het nieuwe virus werden ontworpen voor RT-PCR-detectie van dit menselijke met menselijke longontsteking geassocieerde Coronavirus-genoom in klinische monsters. Van de 44 nasofarynxmonsters die beschikbaar zijn van de 50 SARS-patiënten, hadden er 22 bewijs van menselijk pneumonie-geassocieerd Coronavirus RNA”.

De helft van de geteste patiënten, die allemaal dezelfde symptomen hadden, testten positief voor dit nieuwe vermeende virus. Niemand weet waarom de andere helft negatief testte voor dit nieuwe SARS-CoV-virus. De vraag werd niet gesteld.

Dit vermeende virus had slechts een 57%-sequentie die overeenkwam met het zogenaamd bekende Coronavirus. De andere 43% was gewoon ‘daar’. De gegevens werden geproduceerd en opgenomen als een nieuw genoom als GenBank Accession No. AY274119.

De Wuhan-onderzoekers vonden vervolgens een sequentie van 79,6% die overeenkomt met AY274119 en noemden het daarom een nieuwe stam van SARS-CoV (2019-nCoV – uiteindelijk omgedoopt tot SARS-CoV-2). Niemand had in enig stadium van dit proces een geïsoleerd, gezuiverd monster van een virus geproduceerd. Het enige wat ze hadden was een percentage van de sequentie van het virus dat overeenkwam met een andere percentage van de sequentie.

Niets geïsoleerd

Onderzoekers zijn erg geïrriteerd omdat ze zeggen dat het virus is geïsoleerd, maar niemand gelooft ze. Dit komt omdat nog niemand een enkel gezuiverd monster van het SARS-CoV-2-virus heeft geleverd. Wat we in plaats daarvan hebben, is een voltooid genoom en, zoals we op het punt staan te ontdekken, is het niet bepaald overtuigend.

Onderzoeksjournalisten Torsten Engelbrecht en Konstantin Demeter vroegen enkele van de wetenschappers die zeiden beelden te hebben van SARS-C0V-2 virussen om te bevestigen dat het om beelden van een geïsoleerd, gezuiverd virus gaat. Geen van hen kon dat.

In Australië maakten onderzoekers van het Doherty Institute bekend dat ze het SARS-CoV-2-virus hadden geïsoleerd. Toen hen werd gevraagd om opheldering, zeiden de onderzoekers:

“We hebben korte (RNA) sequenties van de diagnostische test die kunnen worden gebruikt in de diagnostische tests”.

Dit verklaart waarom de Australische regering zegt:

“De betrouwbaarheid van covid-19-tests is onzeker vanwege de beperkte bewijsbasis… Er is beperkte informatie beschikbaar om de nauwkeurigheid en klinische bruikbaarheid van beschikbare covid-19-tests te beoordelen.”

In het Verenigd Koninkrijk schreef een groep bezorgde academici in juli een brief aan de Britse premier Boris Johnson waarin ze hem vroegen om dit te doen:

“Onafhankelijk peer reviewed wetenschappelijk bewijs te produceren dat bewijst dat het Covid-19 virus is geïsoleerd.”

Tot op heden hebben ze geen antwoord ontvangen.

Evenzo heeft de Britse onderzoeker Andrew Johnson een Freedom of Information Request to Public Health England (PHE) gedaan. Hij vroeg hen hem hun dossiers te bezorgen waarin de isolatie van een SARS-COV-2-virus wordt beschreven. Daarop antwoordden ze:

“PHE kan bevestigen dat het geen informatie bevat op de manier die in uw verzoek wordt gesuggereerd.”

De Canadese onderzoeker Christine Massey deed een soortgelijk verzoek om vrijheid van informatie en vroeg de Canadese regering hetzelfde te doen. Waarop de Canadese regering antwoordde:

“Na een grondige zoektocht, betreuren we het om u te informeren dat we niet in staat waren om gegevens te vinden die aan uw verzoek voldoen.”

In de Verenigde Staten stelt het Center for Disease Control (CDC) RT-PCR Diagnostic Panel:

“…Er zijn momenteel geen gekwantificeerde virusisolaten van de 2019-nCoV beschikbaar……..Detectie van viraal RNA wijst mogelijk niet op de aanwezigheid van besmettelijk virus of op het feit dat 2019-nCoV de oorzaak is van de klinische symptomen”.

Voor het laatst bijgewerkt op 13 juli 2020, is de CDC er nog niet in geslaagd om een ​​puur virusmonster te extraheren van een patiënt die naar verluidt de Covid-19-ziekte heeft. Ze geven openlijk toe dat hun testen niet noodzakelijk aantonen of SARS-CoV-2 aanwezig is of Covid-19 veroorzaakt.

Ons wordt verteld dat niets van dit alles van belang is. Dat we onwetend zijn en de virologie gewoon niet begrijpen. Daarom moeten we foto’s van dingen waarvan we weten dat het iets anders zou kunnen zijn en genetische sequenties (die iets anders zouden kunnen zijn) accepteren als sluitend bewijs dat dit virus, en de ziekte die het zou moeten veroorzaken, echt zijn.

Ondanks dat de zogenaamde pandemie al lang aan de gang is, is het onduidelijk of het iemand is gelukt om het SARS-CoV-2-virus te isoleren.

Testen voor niets

De WHO en elke regering, denktank, politieke stuurgroep, wetenschappelijke adviseurs van de overheid, supranationale instellingen en anderen die het officiële Covid-19-verhaal promoten, beweren dat SARS-CoV-2 Covid-19 veroorzaakt.

Hoewel niemand ooit een monster van dit vermeende virus heeft geproduceerd, is het vermeende SARS-CoV-2-genoom gepubliceerd. De informatie is publiekelijk beschikbaar.

Belangrijke genetische sequenties in het SARS-CoV-2-genoom zouden specifieke functies hebben. Dit zijn de doeleiwitten die onderzoekers testen om de aanwezigheid van het “virus” te identificeren. Deze omvatten:

  • RNA-polymerase (Rd-Rp) gen – Hiermee kan het SARS-CoV-2 RNA zich in het cytoplasma van COVID 19 zieke epitheelcellen repliceren.
  • S-gen (Orf2) – dit glycoproteïne vormt de piek op het SARS-CoV-2 virionenoppervlak, wat de binding van SARS-CoV-2 met de ACE2-receptoren op de cellen vergemakkelijkt, waardoor het RNA in het virionele eiwit omhulsel (capsid) in de nu geïnfecteerde cel kan overgaan.
  • E-gen (Orf1ab) – klein membraaneiwit dat wordt gebruikt bij virale assemblage.
  • N-gen (Orf9a) – het nucleocapside-gen dat RNA bindt bij capside-vorming.

De WHO houdt een openbaar beschikbaar register bij van RT-PCR-primers en sondes die worden gebruikt om op SARS-CoV-2 te testen. De primers zijn specifieke nucleotidesequenties die binden (annealen) aan de antisense- en sense-strengen van het gesynthetiseerde cDNA (ze worden respectievelijk forward en reverse primers genoemd).

De cDNA’s worden gescheiden bij verhitting en samengevoegd bij afkoeling. Voorafgaand aan afkoeling worden nucleotidesequenties genaamd probes geïntroduceerd om te hechten aan specifieke doelgebieden in het vermoedelijke virale genoom. Tijdens amplificatie, als de gebieden tussen de primers langer worden, als een primer een sonde raakt, vervalt de sonde en geeft een fluorescerende stof of kleurstof vrij die vervolgens door onderzoekers kan worden gelezen.

Het is de identificatie van deze markers die wetenschappers beweren de aanwezigheid van SARS-CoV-2 in een monster aan te tonen.

Iets anders dat publiekelijk beschikbaar is, is de Basic Local Alignment Search Tool (BLAST). Dit stelt iedereen in staat om gepubliceerde nucleotidesequenties te vergelijken met alle sequenties die zijn opgeslagen door de Amerikaanse National Institutes of Health (NIH) genetische database genaamd GenBank. Daarom kunnen we de geclaimde SARS-CoV-2 primers, probes en target-gen-sequenties BLASTEN.

Voorwaartse, omgekeerde primers en probe-protocollen van de WHO, voor het vermeende virusgenoom SARS-CoV-2, zijn gebaseerd op RdRp-, Orf1-, N- en E-genprofielen. Iedereen kan ze door BLAST laten lopen om te zien wat er te vinden is.

De vitale RdRP-nucleotidesequentie, gebruikt als een voorwaartse primer, is – ATGAGCTTAGTCCTGTTG. Als we een nucleotide BLAST uitvoeren, zien we dat dit wordt geregistreerd als een compleet SARS-CoV-2-isolaat met een 100 procent overeenkomende sequentie-identiteit. Evenzo toont de omgekeerde E-primersequentie – ATATTGCAGCAGTACGCACACA – de aanwezigheid van de Orf1ab-sequentie die ook SARS-CoV-2 identificeert.

Maar BLAST stelt ons ook in staat om de nucleotidesequenties van het microbiële en menselijke genoom te doorzoeken. Als we zoeken naar de RdRp SARS-CoV-2-sequentie, worden 99 menselijke chromosomen (of chromosoomfragmenten) gevonden met een sequentie-overeenkomst van 100 procent. Orf1ab (het E-gen) retourneert 90 met een 100 procent sequentie-overeenkomst met menselijke chromosomen.

Door hetzelfde te doen voor deze sequenties met een microbiële zoekopdracht worden 92 microben gevonden met een 100% match met het SARS-CoV-2 E gen en 100 gematchte microben, met een 100% sequentie-identiteit, met het vitale SARS-CoV-2 RdRp gen.

Wanneer we de zogenaamde unieke genetische markers voor SARS-CoV-2, vastgelegd in de WHO-protocollen, controleren, vinden we volledige of hoge percentage overeenkomsten met verschillende fragmenten van het menselijk genoom. Dit suggereert dat de genetische sequenties, die verondersteld worden SARS-CoV-2 te identificeren, niet uniek zijn. Ze kunnen van alles zijn, van microbiële sequenties tot fragmenten van menselijke chromosomen.

Zogenaamde factcheckers, zoals Reuters’ Health Feedback project, hebben snel beweringen afgewezen van degenen die de aandacht hebben gevestigd op het schijnbare gebrek aan specificiteit in het vermeende SARS-CoV-2-genoom.

Met veel stroman-argumenten zoals “deze claim suggereert dat elke test positief zou moeten zijn”, (wat niet het geval is) klinken hun debunking ongeveer als volgt:

“De primers zijn ontworpen om te binden aan specifieke nucleotidesequenties die uniek zijn voor het virus. De forward primer kan binden aan een specifiek chromosoom, maar de reverse primer bindt niet aan hetzelfde chromosoom en daarom is het chromosoom niet aanwezig in het SARS-CoV-2-virus. Omdat de voorwaartse en omgekeerde primers de te amplificeren sequentie omsluiten, is de cDMA-sequentie tussen de primers ook uniek voor het virus”.

Dit lijkt de betekenis van deze bevindingen opzettelijk verkeerd voor te stellen door een argument door te geven dat niemand anders dan de factcheckers zelf maken. Uit BLAST-onderzoeken blijkt dat deze doelsequenties niet uniek zijn voor SARS-CoV-2. Ook hoeven niet alle doelwitten te worden gevonden om een resultaat als positief te beschouwen.

Marokkaanse onderzoekers hebben de epidemiologie van Marokkaanse vermeende gevallen van SARS-CoV-2 onderzocht. Negen procent was positief voor drie genen, achttien procent was positief voor twee genen en drieënzeventig procent voor slechts één gen. Zoals we zojuist hebben besproken, waren velen misschien positief voor geen enkel gen.

Dit is geheel in overeenstemming met de testrichtlijnen van de WHO. Ze stellen:

“Een optimale diagnose bestaat uit een NAAT [nucleïnezuuramplificatietest] met ten minste twee genoom-onafhankelijke doelen voor SARS-CoV-2; maar in gebieden waar de verspreiding wijdverbreid is, kan een eenvoudig algoritme voor één doel worden gebruikt … Een of meer negatieve resultaten sluiten niet noodzakelijk SARS-CoV-2-infectie uit”.

Ongeacht de valse argumenten van goed gefinancierde “factcheckers”. Als de voorwaartse en achterwaartse primers puin identificeren, misschien het ene het fragment van een chromosoom, en het andere een microbiële sequentie, dan is het geamplificeerde gebied daartussen waarschijnlijk ook troep.

Het argument dat RT-PCR alleen RNA vindt, is misleidend. Natuurlijke transcriptie (scheiding van DNA-strengen) vindt plaats onder “genexpressie”. Niemand zegt dat de sequentie van hele chromosomen of microben wordt bepaald in het vermeende SARS-CoV-2-genoom. Hoewel ze dat wel kunnen, voor zover we weten. Ze zeggen dat de vermeende markers, die gebruikt worden om te testen op dit vermeende virus, niet geschikt zijn voor het doel.

RT-PCR-testen geven geen sequentie aan het volledige genoom. Ze zoeken naar incidenten van specifieke sondeflorescentie om de aanwezigheid van sequenties aan te geven die zouden bestaan. Deze sequenties worden gedefinieerd door MN908947.1 en de daaropvolgende updates. Deze primers en sondes kunnen niets anders onthullen dan RNA dat is geëxtraheerd uit niet-codering, soms ook wel “junk”(troep) genoemd, DNA (cDNA).

Het is bijvoorbeeld de bedoeling dat het SARS-CoV-2 S-gen zeer specifiek is voor het SARS-CoV-2-virusgenoom. De doelsequentie is – TTGGCAAAATTCAAGACTCACTTTC. Een microbiële BLAST-zoekactie levert 97 microbiële overeenkomsten op met een 100%-identiteitsvolgorde. Het laagste identiteitspercentage match, binnen de top 100, is 95%. Een menselijk genoom BLAST vindt ook een 100%-sequentie match met 86 menselijke chromosoomfragmenten.

Het maakt niet uit waar je kijkt in het veronderstelde genoom van SARS-CoV-2, er is niets in de WHO-testprotocollen dat duidelijk aangeeft wat het is. Het hele genoom kan vals zijn. De tests bewijzen het bestaan van SARS-CoV-2 niet. Het enige wat ze onthullen is een soep van ongespecificeerd genetisch materiaal.

Als dat het geval is, omdat er geen isolaten of gezuiverde monsters van het virus zijn, zonder een realistische test, is er geen bewijs dat SARS-CoV-2 bestaat. Daarom is er ook geen bewijs dat er een ziekte bestaat die Covid-19 heet.

Dit betekent dat er geen wetenschappelijke basis is voor beweringen over COVID 19-gevallen, ziekenhuisopnames of sterftecijfers. Alle maatregelen die worden genomen om dit dodelijke virus te bestrijden, zijn mogelijk op niets gebaseerd.

Op bewijzen gebaseerde fraude

Fraude is een misdaad. De juridische definitie van fraude is:

“Elke bedrieglijke praktijk of opzettelijk apparaat, gebruikt met de bedoeling een ander zijn recht te ontnemen of op enigerlei wijze de persoon schade toe te brengen.”

De juridische definitie van een samenzwering is:

“Een combinatie of verbond tussen twee of meer personen die zijn gevormd met het doel om, door hun gezamenlijke inspanningen, een onwettige of criminele handeling te plegen”.

Het lijkt erop dat degenen die beweren dat we te maken hebben met een pandemie geen bewijs hebben geleverd dat een virus genaamd SARS-CoV-2 een ziekte veroorzaakt die COVID 19 heet. Alle informatie die sterk suggereert dat deze mogelijkheid bestaat, is gemakkelijk beschikbaar in het publieke domein. Iedereen kan het lezen.

Om fraude te laten plaatsvinden, moet het bedrog opzettelijk zijn. De bedoeling moet zijn om opzettelijk anderen hun rechten te ontnemen of hen op een andere manier schade toe te brengen. Als er aanwijzingen zijn van samenspanning tussen individuen en / of organisaties om fraude te plegen, is dit een samenzwering (“in Common Law-rechtsgebieden”) of een Joint Criminal Enterprise (JCE) onder internationaal recht.

Het lijkt erop dat covid-19 opzettelijk is gebruikt als een casus belli om oorlog te voeren tegen de mensheid. We zijn opgesloten in onze eigen huizen, onze mobiliteit is beperkt, de vrijheid van meningsuiting is uitgehold, het recht om te protesteren is beperkt, gescheiden van onze dierbaren, onze bedrijven zijn vernietigd, psychologisch gebombardeerd, gemuilkorfd en geterroriseerd.

Erger nog, terwijl er geen bewijs is van een nooit eerder geziene algehele oorzaak van sterfte, waren er onredelijke pieken in het aantal doden, komen deze precies overeen met de lockdown -maatregelen, waarbij de gezondheidsdiensten die wij betalen werden ingetrokken en de openbare gezondheidsdiensten werden geheroriënteerd om een vermeende ziekte te behandelen met uitsluiting van alle andere ziekten.

Bovendien wordt door degenen die het van Covid-19 propageren, gesuggereerd dat deze vermeende ziekte een rechtvaardiging vormt voor de volledige herstructurering van de wereldeconomie, onze politieke systemen, samenlevingen, culturen en de mensheid zelf.

Om te mogen deelnemen aan hun zogenaamde “nieuwe normaal”, Great Reset, dat is de grootschalige transformatie van onze hele samenleving zonder onze toestemming, staan zij erop dat wij ons onderwerpen aan hun voorwaarden.

Deze omvatten, maar zijn niet beperkt tot, biometrische monitoring van iedereen, gecentraliseerde controle en monitoring van al onze transacties, onderdrukkende zakelijke en sociale beperkingen, en een effectieve eis dat we geen recht hebben op soevereiniteit over ons eigen lichaam. Dit is de definitie van slavernij.

Het lijdt geen twijfel dat ons onze rechten zijn ontnomen en dat we gekwetst zijn. In rechtsgebieden van het gewoonterecht wordt onschuld verondersteld, maar het bewijs dat er opzettelijk schade is aangericht door een internationale samenzwering is overweldigend. Destructief beleid, uitgevaardigd door regeringen over de hele wereld, is duidelijk ontstaan onder globalistische denktanks en supranationale instellingen lang voordat deze niet-bestaande pandemie zich voordeed.

In de rechtsgebieden van de Napoleontische Code wordt schuld verondersteld. Om de beschuldigde samenzweerders in staat te stellen hun onschuld te bewijzen, moeten zij aantonen dat zij, ondanks hun onmetelijke middelen, collectief niet in staat zijn geweest om toegang te krijgen tot of inzicht te krijgen in het vrij beschikbare bewijs dat suggereert dat Covid-19 een mythe is.

Degenen die verantwoordelijk zijn voor de misdaad van samenzwering om globale fraude te plegen, moeten worden vervolgd. Als ze schuldig worden bevonden, moeten ze worden opgesloten, terwijl de rest van ons blijft proberen de schade te herstellen die ze al hebben veroorzaakt.

87.000 Nederlandse artsen en verpleegkundigen weigeren zich te laten vaccineren

6 REACTIES

  1. Complex verhaal, voornamelijk het wetenschappelijke deel ervan.
    Je dient een gedegen opleiding microbiologie gevolgd te hebben om daar in mee te kunnen denken.
    Het mag allemaal wel plausibel klinken maar ik weet nu niet of het dat ook is?
    Mij ontbreekt ook de tijd, zin, intelligentie, etc om zelf eea uit te zoeken.
    Ik mag dus alleen maar hopen dat er mensen zijn die wel nuttige inbreng hebben tegen de naar mijn gevoel geënsceneerde covid 19 hoax.
    Het bestaan van asociaal rijke lui/psychopaten als gatess/sschwab/ssoros etcccc maken mijn vertrouwen er niet beter op.

  2. Ik heb die hele Corona affaire nooit vertouwd.
    Mijn punten:
    –waarom kregen bejaarden geen medische behandeling (zagen zelfs geen doctor vaak) werden appart gezet en kregen morfine shot–pure moord.
    –waarom bemoeide de staat 9de linkse fascisten) zich met het voorschrijven van al 70 jaar toegelaten medicijnen, die goed werkten?
    Een pil ivermectine voorkomt meer covid dan muilkorven en lockdown
    –de lockdown is bedoeld om de bevolking te verarmen; heeft NIETS met corona te maken
    –corona heeft veel minder doden dan een standaard griepje; het is geen pandemie, geen epedemie.

    het is het grofste machtsmisbruik in de geschiedenis van europa; en kan alleen plaatsvinden door de slaafse onderdanigheid van de bevolking.

    Note; lenin zei ook “De enige sociale verandering komt uit de loop van een geweer”Wordt hoog tijd; het is dat, of totale ondergang.

LAAT EEN REACTIE ACHTER

Please enter your comment!
Please enter your name here