Al meer dan een jaar vertellen onze betrouwbare “gezondheidsdeskundigen en factcheckers” ons dat mRNA-vaccins, waaronder Pfizer en Moderna, zich niet in het menselijke cel-DNA integreren. Uit een nieuwe explosieve studie, gepubliceerd in Current Issues of Molecular Biology, blijkt echter dat de gezondheidsdeskundigen en factcheckers ongelijk hadden, schrijft Baxter Dmitry.

Uit laboratoriumonderzoek blijkt dat mRNA-vaccins zich WEL degelijk in het cellulair DNA van de mens integreren. In wezen veranderen de vaccins uw DNA voor altijd.

Wat het zegt is: laboratoriumstudies tonen aan dat mRNA vaccin zich WEL integreert in het cellulair DNA van de mens. Dat betekent dat een injectie met een Pfizer vaccin, ook al is het maar één keer genomen, het DNA van de aangetaste cellen blijvend verandert.

De mainstream media en factcheckers hebben zich erop toegelegd ons het tegendeel te vertellen:

Klik voor groot

Maar het brisante artikel uit Current Issues of Molecular Biology suggereert dat zij al die tijd desinformatie aan het verspreiden zijn geweest.

Een nieuwe studie is uit: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

IgorChudov doet verslag:

Wat het zegt is: uit laboratoriumstudies blijkt dat het mRNA-vaccin zich WEL integreert in het menselijke cel-DNA. Dat betekent dat een injectie met het Pfizer vaccin, ook al is het maar één keer genomen, het DNA van de aangetaste cellen permanent verandert.

Wat het artikel laat zien is dat in vitro, met behulp van een menselijke levercellijn, het mRNA-vaccin van Pfizer gebruik maakt van een natuurlijk omgekeerd transcriptase enzym, LINE-1 genaamd, en dat de genetische code van het vaccin omgekeerd getranscribeerd wordt in het DNA.

Nederlandse boeren brengen tank naar mestprotest; agenten schieten op tractor - VIDEO'S UPDATE!

Het verklaart ook dat het mRNA van het vaccin inderdaad naar de lever reist, als één van de voorkeursplaatsen (de andere plaatsen, zoals wij gehoord hebben, zijn de eierstokken en meer).

Wat betekent dit? Normaal gesproken doen onze cellen het omgekeerde: de celkern, waar het DNA zit, drukt bepaalde DNA-code uit op basis van de omstandigheden van de cel, en produceert natuurlijk, menselijk boodschapper-RNA. Dat boodschapper-RNA reist de celkern uit, waar het tot expressie komt in eiwitten die nodig zijn voor de celopbouw. Zo brengen groeiende organismen verschillende genetische programma’s tot expressie om spiercellen of hersencellen te kweken, enz.

Dit proces heet “transcriptie”.

Jarenlang stelde het Centrale Dogma van de Moleculaire Biologie dat de “omgekeerde transcriptie” – het verplaatsen van de genetische code van RNA terug naar de heilige celkern en het opnieuw coderen van het DNA – onmogelijk was. Uiteindelijk hebben de wetenschappers ingezien dat het onder verschillende omstandigheden wel mogelijk is. Het HIV RNA-virus bijvoorbeeld is daartoe in staat en het herprogrammeert ons DNA om er kopieën van te maken. HIV is het virus dat AIDS veroorzaakt.

Om omgekeerde transcriptie te bewerkstelligen, zijn enzymen nodig die “omgekeerde transcriptases” heten. Eén daarvan heet LINE-1.

Blijkbaar, zo blijkt uit een studie, zorgt het Pfizer mRNA-vaccin ervoor dat cellen dat LINE-1 enzym produceren.

Nadat zij LINE-1 reverse transcriptase hadden zien toenemen, hebben zij getest op veranderingen in het DNA, om er zeker van te zijn dat zij niet in plaats daarvan het RNA oppikken.

De genetische code die zij oppikten is:

Twee vrouwen laten zien hoe krankzinnig de COVID-manie mensen heeft gemaakt

CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Wil iemand er BLAST op uitvoeren?

Vereenvoudigd

Zoals ik in antwoord op een vraagsteller heb uitgelegd:

Het mRNA-vaccin van Pfizer verandert onze genetische code, die bepaalt hoe onze organismen werken, die u van uw vader en moeder geërfd hebt. Nu is uw DNA veranderd ten opzichte van wat uw vader en moeder u gegeven hebben, door er een kleine mysterieuze “edit” van Pfizer aan toe te voegen.

Uw organisme werkt in overeenstemming met uw DNA-programma, en nu, wel, is dat programma gehackt en gewijzigd door Pfizer.

Kankercode

Gezien het feit dat het “spike-eiwit” Sars-Cov-2 een kankercode heeft van Moderna 2017 octrooi 9,587,003, is het absoluut noodzakelijk om uit te zoeken wat de implicaties zijn van deze omgekeerde transcriptie, en of de gevaccineerden nu een ongewenste genetische code in hun DNA ingebakken hebben gekregen.

Van bijzonder belang is of deze mRNA-geïnduceerde omgekeerde transcriptie de “kiembaan”, zoals eicellen en zaadcellen, aantast, en of het ook de foetus van zwangere moeders aantast.

Wij verzoeken u dit artikel wijd en zijd te herpubliceren, vanwege de grote implicaties voor onze volksgezondheid.

EDIT: Onze scherpzinnige commentator wees ons op een anonieme 4chan post van Dec 2020, lang voordat hier iets van bekend werd. De datum doet ons allen afvragen: wist deze persoon te veel?


Copyright © 2022 vertaling door Frontnieuws. Toestemming tot gehele of gedeeltelijke herdruk wordt graag verleend, mits volledige creditering en een directe link worden gegeven.

COVID-19 VACCIN DOSSIER

Wetenschapshorror: Vaccin spike-eiwit dringt celkernen binnen, onderdrukt DNA reparatiemotor van het menselijk lichaam, zal explosie van kanker, immunodeficiëntie, auto-immuunziekten en versnelde veroudering ontketenen



Volg Frontnieuws op Telegram

Video-opname van stervende man voor ziekenhuis dat weigert zijn deur te openen - Voorproefje van wat ons de komende tijd te wachten staat?

16 REACTIES

  1. Een goed artikel.
    Een Zweedse studie heeft dit een tijd geleden al vermeld.
    Nu is het dus nog een keeer bevestigd.
    Om deze reden wordt er nu ook aandacht besteed aan het ontstaan van AIDS gerelateerde ziekten tengevolge van het nemen van het vaccin.
    Het Spike eiwit tas het natuurlijke immuunsysteem aan waardoor er niet meer op een natuurlijke manier antistoffen tegen ziekten worden gemaakt.

    In de toekomst zullen gevaccineerden de keus hebben ….. of iedere drie maanden een booster met antistoffen, omdat ze geen of onvoldoende antistoffen meer kunnen produceren, en dan maar bij herhaling dit gif in je lijf laten spuiten ………. of proberen met veel soorten vitaminen en Ivermectine ( wat een virus remmer is (( het virus kan niet goed in de cel binnen dringen )) allerlei infectieziekten buiten je lichaam te houden…….. maar ja daar wordt te weinig aan verdient.
    En dus verboden !!!! want dit is geen pandemie meer maar een ordinaire farmaceutisch verdienmodel.
    Dit is een zeer gevaarlijke situatie omdat een huis tuin en keuken virusje al dodelijk kan zijn.

    • Ja bijna iedereen heeft geen weerstand meer en zodoende moeten ze wel na de eerste vaccin ieder jaar een prik nemen net als de zogenaamde griep-prik> mensen eten dieren en dat = boosdoener nr 1 + alle suikers.. en dan nog alle liefdeloosheid die er heerst overal>>>is er al een pil tegen de ziekte van downsyndroom waar 99,95% aan lijd??

  2. Ik wil niet zeggen zei ik al maar ik heb dit zelf ook al herhaaldelijk gepost. Als ex moleculair bioloog heb ik hier voor gewaarschuwd. Fijn dat het weer eens bevestigd is. Fijn ook dat er mensen zijn die niet in deze gruwelijke misdaad trappen. Dank je FN voor dit artikel.

    • Respect voor u!!
      Zelf kan ik het woord moleculair nauwelijks uitspreken.
      (niet wetenschappelijk opgeleid maar heb er ook niet veel affiniteit mee).

      Er zijn gelukkig inderdaad mensen die niet in deze misdaad trappen maar het feit dat er zovelen wél getrapt zijn in deze truc, is zorgwekkend.
      Hoog opgeleid, laag opgeleid maakt geen verschil.

      Hoog ontwikkelde (hoog EQ) mensen, hoogopgeleid én laag opgeleid; trappen er gelukkig >>gelukkig<>helaas<< (voor hen en omgeving) WEL in.

      Ik merk op dat men niet doorheeft HOE ernstige gevolgen deze injectie heeft op een individu maar ook op zijn/haar omgeving/ naasten: "Ja mijn vriendin heeft wel geïnjecteerd maar ik niet hoor…" of "Ja mijn vriend wel maar ik niet hoor" – ik bedoel… je DOET het met die persoon……. *maag draait ervan*.

  3. Met de correctie dat het niet om een vaccin gaat!!!!!!

    Dit is voor degenen in landen als Frankrijk (waar vaccins verplicht kunnen worden gesteld) juridisch van wezenlijk belang!!!!

    (gedurende het proces de definitie van vaccin wijzigen is not done en zal ik mij tegen verweren. Weet alleen niet waar en bij wie dit nog kan)

    Zelfs binnen zoekmachines zoeken op “experimentele injecties” leidt alleen nig maar naar sites van ons soort complotdenkers…. Dus het woord vaccin wordt erin geramd door de schoften.

  4. men zat toch ergens reclame te maken voor bio producten die het rNA verwijderen uit je lijf.het wordt hoog tijd dat men de omgekochte Ursulla met haar neus op de feiten drukt eer ze weer een lading spuiten aankoopt zonder onze goedkeuring

  5. Nou aan de idioten die zich vol laten spuiten zou ik willen zeggen ga nu snel dat prikje halen er is nu nog voldoende het spul is geweldig hoor je kan wel honderd jaar er mee worden dat zeg het RIVM Rutte zeg zelfs je kan het eeuwig leven mee hebben maar je moet wel blijven ademen.
    Sterf in vrijheid en verlos ons van al die idioten die Rutte geloven.

  6. De kooplieden van deze wereld (Rotchilds) verleiden door toverij/Grieks(pharmacia) alle volken (WHO)

    Openbaringen 18 vers 23

    Deze schurken horen allen minimaal levenslang te krijgen.
    Een profetie 70 na Chr. geschreven

  7. Dus gevaccineeerde zijn geen 100% mensen meer. Wat gebeurd er als ik een bloedtransfusie krijg van een geprikte. Moeten we al gescheiden bloedbanken gaan opzetten voor puur (ongevaccineerd) menselijk bloed ??

  8. Omgekeerde transcriptie, waarbij het dna veranderd door een invloed van buitenaf is bepaalt geen nieuwe gedachte. De totaal door zijn vakbroeders genegeerde celbioloog Bruce Lipton zegt al jaren dat dit zelfs een normaal dagelijks proces is en schreef hierover boeken. Het is juist dit proces dat vanwege de wisselwerking met de omgeving zorgt voor aanpassing aan de omstandigheden. In één woord noem je dat evolutie. Kunstmatig geknutselde genetische componenten in een spuit stoppen is daarom vergelijkbaar met kleuters die met lucifers spelen. De gevolgen zijn niet te overzien.

LAAT EEN REACTIE ACHTER

Please enter your comment!
Please enter your name here